rgs9bp

Ensembl ID:
ENSDARG00000009466
ZFIN ID:
ZDB-GENE-030728-1
Human Orthologue:
RGS9BP
Human Description:
regulator of G protein signaling 9 binding protein [Source:HGNC Symbol;Acc:30304]
Mouse Orthologue:
Rgs9bp
Mouse Description:
regulator of G-protein signalling 9 binding protein Gene [Source:MGI Symbol;Acc:MGI:2384418]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16662 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012692 Essential Splice Site 133 254 3 3
Genomic Location:
Chromosome 7 (position 44040504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTTAWAYGTGGCTGTTTTATTGRWCTAATACACATAATTGCTCAAGC[A/T]GGGGGGGCGACAGAGGTGGCTGCACGWGCCCTGAGTCTGCCTGACCTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0wgcd17j