hoxa9a

Ensembl ID:
ENSDARG00000009461
ZFIN ID:
ZDB-GENE-000823-1
Description:
Homeobox protein Hox-A9a [Source:UniProtKB/Swiss-Prot;Acc:Q9PWL6]
Human Orthologue:
HOXA9
Human Description:
homeobox A9 [Source:HGNC Symbol;Acc:5109]
Mouse Orthologue:
Hoxa9
Mouse Description:
homeobox A9 Gene [Source:MGI Symbol;Acc:MGI:96180]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18147 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006934 Nonsense 136 250 1 2
ENSDART00000147736 Nonsense 136 250 2 3
Genomic Location:
Chromosome 19 (position 19216328)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAATGAAACGAATGATGACGGCACGGAATACAGTCYGCRTACTATACTA[C/T]AGCCTGAAGTCTTCACAAACGGRGGATGTTCTACCAAAACAGAAGCAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n5i6ujaz