tmem30c

Ensembl ID:
ENSDARG00000009430
ZFIN ID:
ZDB-GENE-040426-1127
Description:
cell cycle control protein 50C [Source:RefSeq peptide;Acc:NP_956890]
Human Orthologue:
TMEM30C
Human Description:
transmembrane protein 30C [Source:HGNC Symbol;Acc:30443]
Mouse Orthologue:
Tmem30c
Mouse Description:
transmembrane protein 30C Gene [Source:MGI Symbol;Acc:MGI:1918277]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14674 Essential Splice Site Available for shipment Available now
sa18306 Nonsense Available for shipment Available now
sa11632 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012447 Essential Splice Site 139 352 3 7
Genomic Location:
Chromosome 9 (position 31032756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACTCCCGCGATGATGCACAGATGGTGGGGAGGAAGAAMAACCTGAAG[G/A]TGCTCGACGTCTYTTTCACTCCCCTTCTGTTTGCACTCYTTTTTTTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012447 Nonsense 150 352 4 7
Genomic Location:
Chromosome 9 (position 31032962)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTATTTGCTCACATAGGCACCGAGTTCATACTGCGCTCCGTTTCATTA[C/A]GATGCAAACGGGGTACCCATCGCCCCCTGCGGTGCCGTRGCCAACAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012447 Nonsense 225 352 6 7
Genomic Location:
Chromosome 9 (position 31035428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCCGTTTCTCATTGTGGTCTCTCTGTTGTCAGGCACGACTCGGCCYT[T/A]ATACTGGCAGCACTCGGTTTATGAGCTGGATGACACAGACTCCAACAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1fu6tp4e