mef2cb

Ensembl ID:
ENSDARG00000009418
ZFIN ID:
ZDB-GENE-040901-7
Description:
myocyte-specific enhancer factor 2C [Source:RefSeq peptide;Acc:NP_001124434]
Human Orthologue:
MEF2C
Human Description:
myocyte enhancer factor 2C [Source:HGNC Symbol;Acc:6996]
Mouse Orthologue:
Mef2c
Mouse Description:
myocyte enhancer factor 2C Gene [Source:MGI Symbol;Acc:MGI:99458]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20523 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044083 Nonsense 242 475 6 9
ENSDART00000135911 Nonsense 233 474 6 10

The following transcripts of ENSDARG00000009418 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 49971753)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGAATGAATAAAAGCATGCAGGCGAAATCTCCTCCGCCGGTGAACT[T/A]GGGCATGAACAGTCGCAAGCCTGACCTGCGAGTGCTCATCCCGCCTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xhqqty40