LOC555689

Ensembl ID:
ENSDARG00000009402
Human Orthologues:
FAM115A, FAM115C
Human Descriptions:
family with sequence similarity 115, member A [Source:HGNC Symbol;Acc:22201]
family with sequence similarity 115, member C [Source:HGNC Symbol;Acc:26878]
Mouse Orthologues:
Eapa2, Fam115a, Fam115c
Mouse Descriptions:
experimental autoimmune prostatitis antigen 2 Gene [Source:MGI Symbol;Acc:MGI:3042585]
family with sequence similarity 115, member A Gene [Source:MGI Symbol;Acc:MGI:1914665]
family with sequence similarity 115, member C Gene [Source:MGI Symbol;Acc:MGI:2385258]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35773 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030603 Essential Splice Site 203 916 1 8
Genomic Location (Zv9):
Chromosome 15 (position 667691)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 707994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCTTTCCTGTTCCTAGAAATATCCCTTCTACTTGGCGTGCTTTGTCG[T/G]AAGCCTAGCAGACATGCATGCATTATTTCCCATTCTTTAACAAAAATAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link