robo4

Ensembl ID:
ENSDARG00000009387
ZFIN ID:
ZDB-GENE-020809-1
Description:
Robo4 [Source:UniProtKB/TrEMBL;Acc:A4JYG5]
Human Orthologue:
ROBO4
Human Description:
roundabout homolog 4, magic roundabout (Drosophila) [Source:HGNC Symbol;Acc:17985]
Mouse Orthologue:
Robo4
Mouse Description:
roundabout homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1921394]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8702 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21760 Nonsense Available for shipment Available now
sa24878 Nonsense Mutation detected in F1 DNA During 2017
sa6175 Nonsense Mutation detected in F1 DNA During 2017
sa38805 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004127   None 1093 None 19
ENSDART00000123267 Essential Splice Site 60 591 1 11
ENSDART00000145562 Essential Splice Site 60 1134 1 19
Genomic Location (Zv9):
Chromosome 10 (position 32257166)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31358515
KASP Assay ID:
2260-3393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGATGCATCAGCGAGCAKCACACAGAGACYGGGCCCATCGCAGGAAAG[G/A]TAAAACWAATGGCTTTTRTTGGATTATTAAACTTAAGCATTATAATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004127 Nonsense 63 1093 2 19
ENSDART00000123267 Nonsense 104 591 2 11
ENSDART00000145562 Nonsense 104 1134 2 19
Genomic Location (Zv9):
Chromosome 10 (position 32262544)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31363893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCACATTGTCGTGCAGGGCAGAGGGCAACCCTGAGCCCACCATACAGT[G/A]GCTCAGAAATGGCCAACCTCTTGACACGGACAAGATGGATGCGCAGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004127 Nonsense 419 1093 8 19
ENSDART00000123267 Nonsense 460 591 8 11
ENSDART00000145562 Nonsense 460 1134 8 19
Genomic Location (Zv9):
Chromosome 10 (position 32275713)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31377062
KASP Assay ID:
554-7662.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGTGCGGCCCTACGGCAGCAGCCTGTACGGCAGAGAGAGCAACACC[A/T]GACACTTACGAGTGCCAGAGATTGGTGAGAATTACAAACAAACTACTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004127 Nonsense 574 1093 11 19
ENSDART00000123267   None 591 None 11
ENSDART00000145562 Nonsense 615 1134 11 19
Genomic Location (Zv9):
Chromosome 10 (position 32278725)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31380074
KASP Assay ID:
554-5094.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCCTCCTGTGGTGTGTTTTGATGATTACTGCMGTRTTTTTGTACAGG[A/T]GACATATCAGACCAGCCAACCCTRGTGGCAAAAGCTCAGGTAATCCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004127 Nonsense 739 1093 14 19
ENSDART00000123267   None 591 None 11
ENSDART00000145562 Nonsense 780 1134 14 19
Genomic Location (Zv9):
Chromosome 10 (position 32280592)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31381941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAAACGCACACTCCCTGCCCAGCCCAACATGGGAGTCAAGAAGGAAT[C/A]ATGGGAGAAAAATGTCAAGCGTGGTGAGATGTTCATTCATTCTTTATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link