si:ch211-222n4.6

Ensembl ID:
ENSDARG00000009386
ZFIN ID:
ZDB-GENE-091118-7
Human Orthologue:
MPP4
Human Description:
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) [Source:HGNC Symbol;Acc:13680]
Mouse Orthologue:
Mpp4
Mouse Description:
membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) Gene [Source:MGI Symbol;Acc:MGI:238

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16012 Essential Splice Site Available for shipment Available now
sa15310 Nonsense Available for shipment Available now
sa29558 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23899 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 Essential Splice Site 92 641 3 25
ENSDART00000144086 Essential Splice Site 89 331 3 11
ENSDART00000147246   None 263 None 6
Genomic Location (Zv9):
Chromosome 21 (position 17807697)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18955949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGTCCAGCCAGGYCATATGTCTCATATTCAWCTGGACTTTCTCTRCAG[G/A]TTAGCTTTAAAGTTTATTGGCATANTTTTTTAACCAGTTTGTTCCACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 Nonsense 388 641 20 25
ENSDART00000144086   None 331 None 11
ENSDART00000147246 Nonsense 10 263 1 6
Genomic Location (Zv9):
Chromosome 21 (position 17797421)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18945673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRATGTTTCCTTGTCATATTAGCTGGATTTCGTAGWAGTTTGCGTCTCTG[T/A]CGCCGGCGAAGGGSTCAGGCTTTCGGAAYGTCTCARTTCTGCTCCSTTYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 Essential Splice Site 439 641 None 25
ENSDART00000144086   None 331 None 11
ENSDART00000147246 Essential Splice Site 61 263 None 6
Genomic Location (Zv9):
Chromosome 21 (position 17797268)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18945520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATACCAACACCATCCAGAACACACACACCGCCTCATAGCACTGATAGG[T/C]GAGTGTGTCTGAAGAGCTCTTCATAGTTCTATTAGTGGGTATCTAAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012574 Nonsense 572 641 24 25
ENSDART00000144086   None 331 None 11
ENSDART00000147246 Nonsense 194 263 5 6
Genomic Location (Zv9):
Chromosome 21 (position 17793365)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18941617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGATGAAGCGCACTCGGATGAACTCCAATATCATCACAAATTACTA[T/G]ACAAGCCGACCTTTTAGGGTAACTGTTCATCTTTACCTTTGCCTACTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link