diras1b

Ensembl ID:
ENSDARG00000009372
ZFIN ID:
ZDB-GENE-070912-620
Description:
DIRAS family, GTP-binding RAS-like 1 [Source:RefSeq peptide;Acc:NP_001119893]
Human Orthologue:
DIRAS1
Human Description:
DIRAS family, GTP-binding RAS-like 1 [Source:HGNC Symbol;Acc:19127]
Mouse Orthologue:
Diras1
Mouse Description:
DIRAS family, GTP-binding RAS-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183442]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5153 Nonsense F2 line generated During 2017
sa1796 Missense F2 line generated During 2017

Mutation Details

Allele Name:
sa5153
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003432 Nonsense 26 227 3 3
ENSDART00000137967   None 198 1 1
Genomic Location (Zv9):
Chromosome 2 (position 36780776)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37077486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAACCATTTGTTTTCTCTCTACTAGGTCWAGAACGTCAGTGGCTCAAT[C/T]AAAGGCCCAAGATGCCTGAGCAGAGCAACGACTATCGTGTGGTGGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1796
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003432 Missense 72 227 3 3
ENSDART00000137967 Missense 43 198 1 1
Genomic Location (Zv9):
Chromosome 2 (position 36780637)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37077347
KASP Assay ID:
554-1788.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGTGAAAGGAACCTTCAGGGACACCTACATCCCGACGGTGGAAGACA[C/T]TTACCGGCAGGTGATCAGCTGTGACAAGAGCGTCTGCACCCTGCAGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link