fgf6a

Ensembl ID:
ENSDARG00000009351
ZFIN ID:
ZDB-GENE-980526-559
Description:
fibroblast growth factor 6a [Source:RefSeq peptide;Acc:NP_001001398]
Human Orthologue:
FGF6
Human Description:
fibroblast growth factor 6 [Source:HGNC Symbol;Acc:3684]
Mouse Orthologue:
Fgf6
Mouse Description:
fibroblast growth factor 6 Gene [Source:MGI Symbol;Acc:MGI:95520]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24638 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016591 Nonsense 36 205 1 3
Genomic Location:
Chromosome 25 (position 17302922)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACTGCGGTTGTTCTGCTGGGCTTTCTGATTGGGATCGTGTCCTCCTA[C/A]CCCACCTCGGACAGGACTAATGCAACTTCACTGGAGAAAAGGTGGGAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dmjbrq2b