caprin1a

Ensembl ID:
ENSDARG00000009346
ZFIN ID:
ZDB-GENE-040801-226
Description:
GPI-anchored membrane protein 1 [Source:RefSeq peptide;Acc:NP_001003484]
Human Orthologue:
CAPRIN1
Human Description:
cell cycle associated protein 1 [Source:HGNC Symbol;Acc:6743]
Mouse Orthologue:
Caprin1
Mouse Description:
cell cycle associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1858234]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16512 Essential Splice Site Available for shipment Available now
sa20949 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101018 Essential Splice Site 251 657 8 18
ENSDART00000128110 Essential Splice Site 251 670 7 18
Genomic Location:
Chromosome 7 (position 28133798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCCCTGCATGGCTGATGGCTCGTGTTTATGTTCTTTGTTTGTTCACA[G/T]AGGGAGCTGCTCAGGAATACTCAGAAACTGAGGTTGAAGCAAYAGAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101018 Essential Splice Site 294 657 9 18
ENSDART00000128110 Essential Splice Site 294 670 8 18
Genomic Location:
Chromosome 7 (position 28136224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCAGCAGTGAAAAAGAGCAAGGAGCAGAGTGGAACACAAGTTCTCAGG[T/C]AAGATGCACCTCATTTGTCAATGAAAGTTTGGAATTGGAAGCAACCCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/li9yggxx