txndc5

Ensembl ID:
ENSDARG00000009342
ZFIN ID:
ZDB-GENE-040426-1951
Description:
thioredoxin domain-containing protein 5 [Source:RefSeq peptide;Acc:NP_998181]
Human Orthologue:
TXNDC5
Human Description:
thioredoxin domain containing 5 (endoplasmic reticulum) [Source:HGNC Symbol;Acc:21073]
Mouse Orthologue:
Txndc5
Mouse Description:
thioredoxin domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2145316]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16769 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002394 Nonsense 241 327 8 10
ENSDART00000145815 Nonsense 317 403 8 10
Genomic Location (Zv9):
Chromosome 24 (position 8060656)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7917948
KASP Assay ID:
2261-8428.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAACTTTGACGAGACTGTTGCCAAAGGACTCTCCTTCATCAAGTTCTA[T/A]GCCCCATGGTAAGTGTAGAAGTGTCTCATTTGACTTTTCTTTCTTATAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link