Q32PV1_DANRE

Ensembl ID:
ENSDARG00000009341
Description:
NRAP protein [Source:UniProtKB/TrEMBL;Acc:Q32PV1]
Human Orthologue:
NRAP
Human Description:
nebulin-related anchoring protein [Source:HGNC Symbol;Acc:7988]
Mouse Orthologue:
Nrap
Mouse Description:
nebulin-related anchoring protein Gene [Source:MGI Symbol;Acc:MGI:1098765]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa170 Nonsense Confirmed mutation in F2 line During 2017
sa35320 Nonsense Available for shipment Available now
sa35321 Nonsense Mutation detected in F1 DNA During 2017
sa42059 Nonsense Mutation detected in F1 DNA During 2017
sa12190 Nonsense Available for shipment Available now
sa12645 Nonsense Available for shipment Available now
sa17073 Essential Splice Site Available for shipment Available now
sa35322 Nonsense Mutation detected in F1 DNA During 2017
sa42060 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa22130 Nonsense Available for shipment Available now
sa6261 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42061 Nonsense Mutation detected in F1 DNA During 2017
sa42062 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa170
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251 Nonsense 198 450 8 15
ENSDART00000124920 Nonsense 197 1861 7 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32256882)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30477859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTCAGTGTTTTCCTGCTGATTTTCAGGTGAAATACACAGAAGAATA[T/A]GAGCAGTCTAAAGGAAAAGGCAGTTTCCCAGCCATGATCACCCCAGGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251 Nonsense 357 450 12 15
ENSDART00000124920 Nonsense 356 1861 11 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32257994)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30478971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATGAACAGCAGAGAGGCAAAGGGAGCTTTCCTGCTATGATTACCCCT[G/T]GATACCAGATGGCCAAGAAAGCACATGACATCGCCAGTGATGTAAGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251 Nonsense 447 450 15 15
ENSDART00000124920 Nonsense 446 1861 14 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32262713)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30483690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGCTCATTTTTCAAAGCTTGCCTTTGCTTGTGTTTGCAGAATAAATA[T/G]AAAGAGAATTACACCAATCACATGAAGGGTCACTATGAAGGGGGCGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251   None 450 None 15
ENSDART00000124920 Nonsense 702 1861 20 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32265168)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30486145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAAGCTCTGGCCAGTGATCTGGAATATAGGAAGAAGTTACATGATTA[T/G]ACTCTCCTGTCTGATGACATGAAAGTGCAGCAAGCTAAAAAAGCCTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251   None 450 None 15
ENSDART00000124920 Nonsense 865 1861 25 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32266706)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30487683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATWCAATCTAAATGATCATTTYTGATGCTTTGTGTATGTAGGTGAAGTA[C/A]AAGCAAAAATMWGAAATGACAAAAGGGAAGATGATTGGCGTGAAGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251   None 450 None 15
ENSDART00000124920 Nonsense 869 1861 25 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32266718)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30487695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATCATTTYTGATGCTTTGTGTATGTAGGTGAAGTAMAAGCAAAAATM[T/A]GAAATGACAAAAGGGAAGATGATTGGCGTGAAGACTGTGGCAGACGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251   None 450 None 15
ENSDART00000124920 Essential Splice Site 1106 1861 30 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32270148)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30491125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGGWTATCTGTCTGACTATTCATTTGAYTGTACAAATATTTACCTTC[A/T]GCWAAAGTACAARGCGCAGTTTGAAAAGACAAAAGGGAAGATGATTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251   None 450 None 15
ENSDART00000124920 Nonsense 1108 1861 30 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32270158)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30491135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCTGACTATTCATTTGACTGTACAAATATTTACCTTCAGCAAAAGTA[C/A]AAAGCGCAGTTTGAAAAGACAAAAGGGAAGATGATTGGGCTAAAGGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251   None 450 None 15
ENSDART00000124920 Splice Site, Nonsense 1209 1861 31 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32270544)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30491521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGACCTCAAAGTGCAGGCTGCAAAGAGAGCTTATGAACTGCAGAGT[G/T]AGGTAATAGCCTGTTATATCTGATTTGGTTATTGAATCTCATTGGCCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251   None 450 None 15
ENSDART00000124920 Nonsense 1327 1861 35 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32273251)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30494228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGGTTAAGTACAAGGAATCATGGAATGTGCTTCGAGCTCAGGGTTA[T/G]AAACTCACCATGAAGGATATCCCCTTCCAAGCTGCCAAAGCATCCACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251   None 450 None 15
ENSDART00000124920 Essential Splice Site 1348 1861 35 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32273316)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30494293
KASP Assay ID:
554-4223.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATATCCCCTTCCAAGCTGCCAAAGCATCCACCAGCATTGCTAGTGATG[T/A]AAGAATACCTCATCTAAATTTACACACATAAACATCTATGGGCAAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251   None 450 None 15
ENSDART00000124920 Nonsense 1391 1861 36 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32273569)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30494546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGCACTGCCTGGAGATGGGCCGTCTGCAGAGCGACCAGCATTATCGT[A/T]AAGACGCCATGTGCACCAGTGGCCAGTATCAGCTGCCTTTAGACATGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124251   None 450 None 15
ENSDART00000124920 Nonsense 1523 1861 39 43
ENSDART00000126984   None 84 None 4
Genomic Location (Zv9):
Chromosome 12 (position 32275441)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30496418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTGGGTCATGCGAATAACAAAATTTTTATCTTCTTATAGAGGATGTA[T/G]AAGTCTGGGGACTCTGACTCCATGCACAAATACACATTGCATGCCGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link