aif1l

Ensembl ID:
ENSDARG00000009336
ZFIN ID:
ZDB-GENE-030131-9646
Description:
allograft inflammatory factor 1-like [Source:RefSeq peptide;Acc:NP_942571]
Human Orthologue:
AIF1L
Human Description:
allograft inflammatory factor 1-like [Source:HGNC Symbol;Acc:28904]
Mouse Orthologue:
Aif1l
Mouse Description:
allograft inflammatory factor 1-like Gene [Source:MGI Symbol;Acc:MGI:1919598]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11473 Essential Splice Site Available for shipment Available now
sa6989 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009500 Essential Splice Site 9 148 None 6
ENSDART00000139317 None None 122 None 5

The following transcripts of ENSDARG00000009336 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 36167652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTGAAGCCTCCAGACCGCTGAATAATTGCTCCCATGTCTCATTTTTCT[A/G]GGCGGAAAAGCCTTCGGGTTGCTCAAAGCTCAGCAGAGGGACAAGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009500 Essential Splice Site 29 148 2 6
ENSDART00000139317 None None 122 None 5

The following transcripts of ENSDARG00000009336 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 36167716)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGGTTGCTCAAAGCTCAGCAGAGGGACAAGCTGGAGGAAATCAATAAG[G/T]NNNNNTAAATGAGCGACCGCTGATGGATTATTATTGTCTCGATCTGGAGGCGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bp38zvl0