clgn

Ensembl ID:
ENSDARG00000009315
ZFIN ID:
ZDB-GENE-060929-708
Description:
calmegin [Source:RefSeq peptide;Acc:NP_001071009]
Human Orthologue:
CLGN
Human Description:
calmegin [Source:HGNC Symbol;Acc:2060]
Mouse Orthologue:
Clgn
Mouse Description:
calmegin Gene [Source:MGI Symbol;Acc:MGI:107472]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17985 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101671 Essential Splice Site 150 630 5 15
Genomic Location:
Chromosome 1 (position 40996650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGCTTAACAAACCATTTGTGTTTAAGGACAAACCTCTCATCGTCCAG[T/C]AAGTGTGTTTTGTATTTGTTGTAAWCTGACATTWGACATACCTTGGATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ds0yyqwx