pvalb6

Ensembl ID:
ENSDARG00000009311
ZFIN ID:
ZDB-GENE-040912-95
Description:
parvalbumin 6 [Source:RefSeq peptide;Acc:NP_991136]
Human Orthologue:
PVALB
Human Description:
parvalbumin [Source:HGNC Symbol;Acc:9704]
Mouse Orthologue:
Pvalb
Mouse Description:
parvalbumin Gene [Source:MGI Symbol;Acc:MGI:97821]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15691 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055606 Essential Splice Site 102 109 None 5
ENSDART00000132387 Essential Splice Site 102 109 None 5
Genomic Location (Zv9):
Chromosome 3 (position 24725666)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24303877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGTTCTTNAAAAAAAANACTAATTCTCTCTCAAWSCTTTTTCTGTTTC[A/G]GAGTTTGCTGCTCTGGTTCGTGAATAAATGACAAAAGGACTCTTGGCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link