si:ch73-310g9.3

Ensembl ID:
ENSDARG00000009281
ZFIN ID:
ZDB-GENE-100920-3
Human Orthologues:
AC013486.1, AC019294.4, AC019322.3, AC027139.3, AC068338.1, AC120045.3, AC135983.3, DNM1, MX1, MX2
Human Descriptions:
dynamin 1 [Source:HGNC Symbol;Acc:2972]
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Putative GED domain-containing protein LOC554175 [Source:UniProtKB/Swiss-Prot;Acc:Q6PK57]
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NN47]
Mouse Orthologues:
Dnm1, Mx1, Mx2
Mouse Descriptions:
dynamin 1 Gene [Source:MGI Symbol;Acc:MGI:107384]
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17577 Nonsense Available for shipment Available now
sa18508 Essential Splice Site Available for shipment Available now
sa14849 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097330 Nonsense 223 840 5 22
ENSDART00000134261 Nonsense 223 846 5 23

The following transcripts of ENSDARG00000009281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 66953527)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63004134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWTTGGATCTAATGGACGAAGGAACCGATGCACGTGAAATCCTTGAGAAC[A/T]AGCTTCTTCCCTTACRCAGAGGTAAAGTCANNACACAAAGAAATAGTGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097330 Essential Splice Site 520 840 15 22
ENSDART00000134261 Essential Splice Site 520 846 15 23

The following transcripts of ENSDARG00000009281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 66975716)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63026323
KASP Assay ID:
2259-6751.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAWACTYTGTCATTTATCTCTTAAAACATGTCCTGTTTGCTTGTGTCTA[G/T]GTGATCAGAAAGRGTTGGCTCACCATCAATAACATTGGYATCATGAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097330 Nonsense 553 840 15 22
ENSDART00000134261 Nonsense 553 846 15 23

The following transcripts of ENSDARG00000009281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 66975818)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63026425
KASP Assay ID:
1641-0478.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCRAAGGAGTACKGGTTTGTCATGACCGCTGAAAATCTGTCCTGGTA[C/A]AAGGATGATGAGGTGAGYGAAGCCTCTTTTCATTCAGCACTGCTCTTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link