ppm1d

Ensembl ID:
ENSDARG00000009273
ZFIN ID:
ZDB-GENE-040426-815
Description:
protein phosphatase 1D magnesium-dependent, delta isoform [Source:RefSeq peptide;Acc:NP_957384]
Human Orthologue:
PPM1D
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1D [Source:HGNC Symbol;Acc:9277]
Mouse Orthologue:
Ppm1d
Mouse Description:
protein phosphatase 1D magnesium-dependent, delta isoform Gene [Source:MGI Symbol;Acc:MGI:1858214]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42560 Nonsense Mutation detected in F1 DNA During 2017
sa22658 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023842 Nonsense 32 535 1 6
Genomic Location (Zv9):
Chromosome 15 (position 26269155)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 27000522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCGGTCGGAAATACATGGAGGACCTAGTAACGATGAAGCAGGAGGAT[G/T]AGCCGAGTGAGGATGAACTGGACGCCGCCGAACGTGGCGAGGTCGAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023842 Nonsense 453 535 6 6
Genomic Location (Zv9):
Chromosome 15 (position 26274154)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 27005521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATCTTCTGACAGCCTTACAAACTCTGAGGACCTGCCCTGTAATGACT[T/A]GCTGGAAAATGGGGCCAGTTGTGACCGAACACCGACTGGCAAACGGGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link