napepld

Ensembl ID:
ENSDARG00000009252
ZFIN ID:
ZDB-GENE-030131-3856
Description:
N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D [Source:RefSeq peptide;Acc:NP_001074082
Human Orthologue:
NAPEPLD
Human Description:
N-acyl phosphatidylethanolamine phospholipase D [Source:HGNC Symbol;Acc:21683]
Mouse Orthologue:
Napepld
Mouse Description:
N-acyl phosphatidylethanolamine phospholipase D Gene [Source:MGI Symbol;Acc:MGI:2140885]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20269 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023337 Essential Splice Site 335 416 4 5
ENSDART00000130687 Essential Splice Site 335 416 5 6
Genomic Location (Zv9):
Chromosome 4 (position 19417875)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20761210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTTTGAATGGGCTTTTAACATGTTATAACATGTCTTGTTTTACTT[A/C]GAGGCATCATGAAATCTCAGCATGTTGATCCTGAAGAGGCTGTTCAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link