fev

Ensembl ID:
ENSDARG00000009242
ZFIN ID:
ZDB-GENE-070112-1852
Description:
Protein FEV [Source:UniProtKB/Swiss-Prot;Acc:A3FEM2]
Human Orthologue:
FEV
Human Description:
FEV (ETS oncogene family) [Source:HGNC Symbol;Acc:18562]
Mouse Orthologue:
Fev
Mouse Description:
FEV (ETS oncogene family) Gene [Source:MGI Symbol;Acc:MGI:2449712]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9291 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093343 None None 235 None 3
ENSDART00000128629 Essential Splice Site 9 215 1 3

The following transcripts of ENSDARG00000009242 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 11827813)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTGGGAGGCCAGAGACAACACGMCAGAAACACACAAAGACATTCAAG[G/A]TGATGACAACGTGCGTCCTTGTCAATGGTGATGCTGAGCTGCTGTTGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q3uqsyaz