tmem180

Ensembl ID:
ENSDARG00000009214
ZFIN IDs:
ZDB-GENE-041212-83, ZDB-GENE-041212-83
Description:
transmembrane protein 180 [Source:RefSeq peptide;Acc:NP_001008654]
Human Orthologue:
TMEM180
Human Description:
transmembrane protein 180 [Source:HGNC Symbol;Acc:26196]
Mouse Orthologue:
Tmem180
Mouse Description:
transmembrane protein 180 Gene [Source:MGI Symbol;Acc:MGI:1922396]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45471 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8936 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004769 Essential Splice Site None 504 1 9
ENSDART00000130853   None 504 None 8
Genomic Location (Zv9):
Chromosome 12 (position 35390929)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33793710
GRCz11 12 33894693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGGAATCCACTGATAGTATTGTGTTTCTATTGAGAGGAATCAGCTGG[G/T]TAAGTGTGTCTGTCTGTCTGCTGGCTGTGACTTGGTCCACGTCGCATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004769 Nonsense 491 504 9 9
ENSDART00000130853 Nonsense 491 504 8 8
Genomic Location (Zv9):
Chromosome 12 (position 35408905)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33811686
GRCz11 12 33912669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGCTTCACTCTGCAYGGGCGCAGGCTACAAAACATYAAGACTCTTCGA[C/T]AGAGTGCCCAACACAGCCACCTCATAGATGTCAAGGCTATATAACACTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link