ctr9

Ensembl ID:
ENSDARG00000009170
ZFIN ID:
ZDB-GENE-030131-3782
Description:
RNA polymerase-associated protein CTR9 homolog [Source:RefSeq peptide;Acc:NP_001077052]
Human Orthologue:
CTR9
Human Description:
Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1685
Mouse Orthologue:
Ctr9
Mouse Description:
Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12664 Nonsense Available for shipment Available now
sa21125 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021317 Nonsense 82 1160 3 23
Genomic Location (Zv9):
Chromosome 7 (position 67292053)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66466393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGGCGCGCATCGACGGAAACCTGGATTACAGAGACCATGAGAAAGAC[C/T]AGATGACCTGTTTGGACACACTAGCAGCTTATTATGTCCAACAGGCTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021317 Nonsense 535 1160 12 23
Genomic Location (Zv9):
Chromosome 7 (position 67303708)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66454738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAATGGTCAGTTAATTTGATTCATTTGATTCTGTAACAGGTTACT[T/A]GCGCCTCGGGGCGATGGCACGTGATAAGGGAAATTTCTATGAAGCTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link