ctr9

Ensembl ID:
ENSDARG00000009170
ZFIN ID:
ZDB-GENE-030131-3782
Description:
RNA polymerase-associated protein CTR9 homolog [Source:RefSeq peptide;Acc:NP_001077052]
Human Orthologue:
CTR9
Human Description:
Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1685
Mouse Orthologue:
Ctr9
Mouse Description:
Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12664 Nonsense Available for shipment Available now
sa5452 Nonsense Mutation detected in F1 DNA During 2014
sa21125 Nonsense Mutation detected in F1 DNA During 2014
sa8296 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021317 Nonsense 82 1160 3 23
Genomic Location:
Chromosome 7 (position 67292053)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGGCGCGCATCGACGGAAACCTGGATTACAGAGACCATGAGAAAGAC[C/T]AGATGACCTGTTTGGACACACTAGCAGCTTATTATGTCCAACAGGCTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021317 Nonsense 330 1160 8 23
Genomic Location:
Chromosome 7 (position 67300790)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTGTTTTTTTTAGGRGGAYTATGACCAAGCGTTCCAGTATTACTA[T/A]CAGGCCACTCARTTTGCTTCATCCACTTTTGTACTGCCATTCTTTGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021317 Nonsense 535 1160 12 23
Genomic Location:
Chromosome 7 (position 67303708)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAATGGTCAGTTAATTTGATTCATTTGATTCTGTAACAGGTTACT[T/A]GCGCCTCGGGGCGATGGCACGTGATAAGGGAAATTTCTATGAAGCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021317 Nonsense 708 1160 16 23
Genomic Location:
Chromosome 7 (position 67308419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGYCTCTACTTACCGACTGCTTTTKTRTCTCTTCAGTATGAAAACTGCT[T/A]GAAGAAGTTCTACAAGTATCAGAACACAGAAGTGCTGCTGTATTTGGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k8oguqho