mobkl1aa

Ensembl ID:
ENSDARG00000009169
ZFIN ID:
ZDB-GENE-040426-919
Description:
mps one binder kinase activator-like 1A [Source:RefSeq peptide;Acc:NP_956494]
Human Orthologue:
MOBKL1A
Human Description:
MOB1, Mps One Binder kinase activator-like 1A (yeast) [Source:HGNC Symbol;Acc:29801]
Mouse Orthologue:
Mobkl1a
Mouse Description:
MOB1, Mps One Binder kinase activator-like 1A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1915723]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33685 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020568 Nonsense 25 215 2 6
ENSDART00000097615 Nonsense 26 216 2 6
Genomic Location (Zv9):
Chromosome 5 (position 44576147)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 42357412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGACGTTCAAGCCGAAGAAGAACATTCCAGAGGGCTCACACCAGTA[C/A]GAGCTGCTGAAACATGCAGAGGCCACGCTGGGCAGCGGAAACCTGCGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link