ftr55

Ensembl ID:
ENSDARG00000009161
ZFIN ID:
ZDB-GENE-070424-161
Description:
Novel protein containing a B-box zinc finger domain [Source:UniProtKB/TrEMBL;Acc:Q1LXL5]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11517 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa11517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019843 Essential Splice Site 192 537 None 6
ENSDART00000121858 Essential Splice Site 182 529 None 7
ENSDART00000136370 Missense 193 199 1 1
Genomic Location:
Chromosome 19 (position 14866270)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAAACCATCACACTGTATCAGCTGTTGCAAAGATRGCAGAGAATGAGG[T/A]ATGTACTGAAACAATACATTAACATTTTGAGGAGCTCATACSTACACTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ppy7m33n