kmo

Ensembl ID:
ENSDARG00000009160
ZFIN ID:
ZDB-GENE-030424-4
Description:
Kynurenine 3-monooxygenase [Source:UniProtKB/Swiss-Prot;Acc:Q1RLY6]
Human Orthologue:
KMO
Human Description:
kynurenine 3-monooxygenase (kynurenine 3-hydroxylase) [Source:HGNC Symbol;Acc:6381]
Mouse Orthologue:
Kmo
Mouse Description:
kynurenine 3-monooxygenase (kynurenine 3-hydroxylase) Gene [Source:MGI Symbol;Acc:MGI:2138151]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42282 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42282
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003706 Nonsense 426 474 14 15
Genomic Location (Zv9):
Chromosome 13 (position 42929896)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42150855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACATTCACCAGAACACGCTACAATGATGCTGTGAACCGTTGGCATTGG[C/T]AAAATAAGGTAAAGACCAAGGGCCCTATCATACACCCGGCGCAATGTGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link