pla2g1b

Ensembl ID:
ENSDARG00000009153
ZFIN ID:
ZDB-GENE-070117-1
Description:
Phospholipase A2, group IB (Pancreas) [Source:UniProtKB/TrEMBL;Acc:A9C458]
Human Orthologue:
PLA2G1B
Human Description:
phospholipase A2, group IB (pancreas) [Source:HGNC Symbol;Acc:9030]
Mouse Orthologue:
Pla2g1b
Mouse Description:
phospholipase A2, group IB, pancreas Gene [Source:MGI Symbol;Acc:MGI:101842]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34456 Nonsense Available for shipment Available now
sa12490 Nonsense Available for shipment Available now
sa136 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa34456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009323 Nonsense 18 151 2 4
Genomic Location (Zv9):
Chromosome 8 (position 41679440)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39693020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCATTGTATCACATAAAGCAATAATCAATGTCACTGTTCAACAGTGT[T/A]GGCGACTCTAGACTATCGTGCACTGTGGCAGTTCAGGGCCATGATCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009323 Nonsense 27 151 2 4
Genomic Location (Zv9):
Chromosome 8 (position 41679468)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39693048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGTCACTGTTCAACAGTGTTGGCGACTCWAGACTATCGTGCACTGTG[G/A]CAGTTCAGGGCCATGATCCTCTGTACCATCCCTGACAGCTGGCCCGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa136
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009323 Nonsense 69 151 3 4
Genomic Location (Zv9):
Chromosome 8 (position 41684310)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39697890
KASP Assay ID:
554-1116.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAAATRTTTATAACCATATTCCTGCTTCTTTATATCTGTAGATGCTG[C/A]CAGGTACACGATCAGTGCTATTCTGACTCGTGGCAACATGACGACTGTTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link