tp53bp2

Ensembl ID:
ENSDARG00000009136
ZFIN ID:
ZDB-GENE-040516-8
Description:
tumor protein p53 binding protein, 2 [Source:RefSeq peptide;Acc:NP_999979]
Human Orthologue:
TP53BP2
Human Description:
tumor protein p53 binding protein, 2 [Source:HGNC Symbol;Acc:12000]
Mouse Orthologue:
Trp53bp2
Mouse Description:
transformation related protein 53 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2138319]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6281 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19048 Nonsense Mutation detected in F1 DNA During 2014
sa10408 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006892 Essential Splice Site 266 1060 8 18
Genomic Location:
Chromosome 13 (position 525823)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGMCATATTGCCAGCCCTACTCCACAGATYACCTGTGTTTGTTCATCA[G/A]ATGCGGAAAAACCTGAACGTGGAGCAGAACGCTAAACTGCAGCAGCARCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006892 Nonsense 781 1060 13 18
ENSDART00000006892 Nonsense 781 1060 13 18
Genomic Location:
Chromosome 13 (position 530689)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCATCCGGCCCCGAAAATTGACGCATCCATTATCATCCCACCGCCA[C/T]AGCCGGAGAGCCCTCCACCTCCACCTCCTCCTGACAGCTTCATGGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006892 Nonsense 781 1060 13 18
ENSDART00000006892 Nonsense 781 1060 13 18
Genomic Location:
Chromosome 13 (position 530689)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTCAYCCGGCCCCRAAAATTGACGCATCCATTATCATCCCACCGCCA[C/T]AGCCGGAGAGCCCTCCACCTCCACCTCCTCCTGACAGCTTCATGGAGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nj65027t