hlx1

Ensembl ID:
ENSDARG00000009134
ZFIN ID:
ZDB-GENE-030131-5304
Description:
H2.0-like homeobox protein [Source:RefSeq peptide;Acc:NP_997866]
Human Orthologue:
HLX
Human Description:
H2.0-like homeobox [Source:HGNC Symbol;Acc:4978]
Mouse Orthologue:
Hlx
Mouse Description:
H2.0-like homeobox Gene [Source:MGI Symbol;Acc:MGI:96109]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11010 Nonsense Available for shipment Available now
sa19249 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004652 Nonsense 183 327 3 4
ENSDART00000131806 Nonsense 212 356 3 4
ENSDART00000143668 Nonsense 156 280 2 3
ENSDART00000004652 Nonsense 183 327 3 4
ENSDART00000131806 Nonsense 212 356 3 4
ENSDART00000143668 Nonsense 156 280 2 3
Genomic Location:
Chromosome 20 (position 52537440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCAAAGACACAATGCCACAGACKTACAAGAGGAAAAGATCCTGGTCC[A/T]GAGCTGTGTTTTCCAACCTGCAGCGGAAAGGCCTGGAGAAACGCTTCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004652 Nonsense 183 327 3 4
ENSDART00000131806 Nonsense 212 356 3 4
ENSDART00000143668 Nonsense 156 280 2 3
ENSDART00000004652 Nonsense 183 327 3 4
ENSDART00000131806 Nonsense 212 356 3 4
ENSDART00000143668 Nonsense 156 280 2 3
Genomic Location:
Chromosome 20 (position 52537440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCAAAGACACAATGCCACAGACGTACAAGAGGAAAAGATCCTGGTCC[A/T]GAGCTGTGTTTTCCAACCTGCAGCGGAAAGGCCTGGAGAAACGCTTCGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f60kncom