si:ch211-260g14.8

Ensembl ID:
ENSDARG00000009123
ZFIN ID:
ZDB-GENE-041014-221
Description:
hypothetical protein LOC558139 [Source:RefSeq peptide;Acc:NP_001124070]
Human Orthologues:
SELE, SELL, SELP
Human Descriptions:
selectin E [Source:HGNC Symbol;Acc:10718]
selectin L [Source:HGNC Symbol;Acc:10720]
selectin P (granule membrane protein 140kDa, antigen CD62) [Source:HGNC Symbol;Acc:10721]
Mouse Orthologues:
Sele, Sell, Selp
Mouse Descriptions:
selectin, endothelial cell Gene [Source:MGI Symbol;Acc:MGI:98278]
selectin, lymphocyte Gene [Source:MGI Symbol;Acc:MGI:98279]
selectin, platelet Gene [Source:MGI Symbol;Acc:MGI:98280]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5955 Nonsense Mutation detected in F1 DNA During 2017
sa15565 Nonsense Available for shipment Available now
sa11522 Nonsense Available for shipment Available now
sa39289 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009440   None 856 None 15
ENSDART00000111022   None 835 1 18
ENSDART00000136834 Nonsense 9 648 1 11
Genomic Location (Zv9):
Chromosome 20 (position 34001522)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34074035
KASP Assay ID:
554-3914.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCCATCAAACAATAAAAGGGGGCAAAAAGTACAGAACTACAAACTAC[A/T]GAAAGGACCATAAACAGGACCACTGCAGAACATCACTGATAATGGTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009440 Nonsense 78 856 3 15
ENSDART00000111022 Nonsense 41 835 3 18
ENSDART00000136834 Nonsense 100 648 3 11
Genomic Location (Zv9):
Chromosome 20 (position 34000791)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34073304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATTGYTCACCTCAACGGAATTCTTCCAAGACGCAATGGCTRTTACTG[G/A]ATTGGTATTCGTWAAATTAATAACCAGTGGACCTGGGTGGGAACTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009440 Nonsense 83 856 3 15
ENSDART00000111022 Nonsense 46 835 3 18
ENSDART00000136834 Nonsense 105 648 3 11
Genomic Location (Zv9):
Chromosome 20 (position 34000778)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34073291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACGGAATTCTTCCAAGACGCAATGGCTATTACTGGATTGGTATTCGT[A/T]AAATTAATAACCAGTGGACCTGGGTGGGAACTAACAAAACACTTACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009440 Essential Splice Site 805 856 None 15
ENSDART00000111022 Essential Splice Site 768 835 None 18
ENSDART00000136834   None 648 None 11
Genomic Location (Zv9):
Chromosome 20 (position 33996483)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34068996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATAGAGTGAGACCGACATTCTACAGCTTTCTCTTTAACTATATTTAC[A/T]GCTCAACCTGGTCCCTCTAAATCGCTCTTCAAAGCAACAGAAGTGGCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link