A5PF47_DANRE

Ensembl ID:
ENSDARG00000009121
Description:
Novel protein similar to cholinergic receptor muscarinic 5 [Source:UniProtKB/TrEMBL;Acc:A5PF47]
Human Orthologue:
CHRM1
Human Description:
cholinergic receptor, muscarinic 1 [Source:HGNC Symbol;Acc:1950]
Mouse Orthologue:
Chrm1
Mouse Description:
cholinergic receptor, muscarinic 1, CNS Gene [Source:MGI Symbol;Acc:MGI:88396]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1605 Nonsense Available for shipment Available now
sa40511 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020646 Nonsense 214 483 1 1
Genomic Location (Zv9):
Chromosome 5 (position 39364007)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37163691
KASP Assay ID:
554-1546.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGATYGCTGCTTTCTACCTACCCGTCAGCATCATGATCATTTTATACTG[G/A]CGAATATATTGGGAGATTGAGAAYCGGGCGAAAGGGCTTGCTGGTTTTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020646 Nonsense 215 483 1 1
Genomic Location (Zv9):
Chromosome 5 (position 39364006)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37163690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTGCTGCTTTCTACCTACCCGTCAGCATCATGATCATTTTATACTGG[C/T]GAATATATTGGGAGATTGAGAATCGGGCGAAAGGGCTTGCTGGTTTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link