pigc

Ensembl ID:
ENSDARG00000009113
ZFIN ID:
ZDB-GENE-030131-2714
Description:
phosphatidylinositol N-acetylglucosaminyltransferase subunit C [Source:RefSeq peptide;Acc:NP_998426
Human Orthologue:
PIGC
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class C [Source:HGNC Symbol;Acc:8960]
Mouse Orthologue:
Pigc
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class C Gene [Source:MGI Symbol;Acc:MGI:1914542]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6623 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010550 Nonsense 11 293 2 2
Genomic Location (Zv9):
Chromosome 20 (position 14728754)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14918000
KASP Assay ID:
554-4899.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTGATTTGGACAGRCGATGGGAGCAGACAGCGGTCCAGGGGCTCCTT[C/A]GGCYGTCCCSTGGAGRAAAGTGCTCTATGAACGGCAGCCTTTCCCAGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link