gata2b

Ensembl ID:
ENSDARG00000009094
ZFIN ID:
ZDB-GENE-040718-440
Description:
GATA-binding protein 2b [Source:RefSeq peptide;Acc:NP_001002689]
Human Orthologue:
GATA2
Human Description:
GATA binding protein 2 [Source:HGNC Symbol;Acc:4171]
Mouse Orthologue:
Gata2
Mouse Description:
GATA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:95662]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14633 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022731 Nonsense 88 427 3 6
ENSDART00000144479 Nonsense 89 428 3 6
Genomic Location:
Chromosome 6 (position 40726636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAAGACTATAACNTTTTTTCNTTTTTGCCAGCACGCCTTACGGGTGGYT[C/A]AATGTRTCGACCTCACCTTATCAACACTCACGGTCTTCCTTTACTGGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0ye7cdx0