cbr4

Ensembl ID:
ENSDARG00000009074
ZFIN IDs:
ZDB-GENE-040426-1796, ZDB-GENE-040426-1796
Description:
Carbonyl reductase family member 4 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0H7]
Human Orthologue:
CBR4
Human Description:
carbonyl reductase 4 [Source:HGNC Symbol;Acc:25891]
Mouse Orthologue:
Cbr4
Mouse Description:
carbonyl reductase 4 Gene [Source:MGI Symbol;Acc:MGI:2384567]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5950 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016913 Nonsense 172 237 5 6
ENSDART00000125678 Nonsense 172 237 5 7
Genomic Location:
Chromosome 20 (position 23639165)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGGGATTCACTCGCTCACTGGCAAAGGAAGTGGCTTCYCGTAACATA[C/T]GAGTGAAYTTGGTGGCTCCAGGTCTTTTTTCCTTTTAATWACCACTAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4idqdplv