tnikb

Ensembl ID:
ENSDARG00000009031
ZFIN ID:
ZDB-GENE-051113-320
Description:
TRAF2 and NCK interacting kinase b [Source:UniProtKB/TrEMBL;Acc:Q32PQ9]
Human Orthologue:
TNIK
Human Description:
TRAF2 and NCK interacting kinase [Source:HGNC Symbol;Acc:30765]
Mouse Orthologue:
Tnik
Mouse Description:
TRAF2 and NCK interacting kinase Gene [Source:MGI Symbol;Acc:MGI:1916264]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6774 Nonsense Mutation detected in F1 DNA During 2016
sa37905 Nonsense Mutation detected in F1 DNA During 2016
sa44157 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008374 Nonsense 41 537 2 14
ENSDART00000017384 Nonsense 41 522 2 14
ENSDART00000097792 Nonsense 41 1410 2 32

The following transcripts of ENSDARG00000009031 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 27402055)
KASP Assay ID:
554-5019.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGAGCTGGTGGAGCTTGTGGGAAATGGRACCTATGGACAAGTATAT[A/T]AGGTAAATATTGACTTTTCTGTTTGATMTGGTTCRTGTGATTGGCTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008374   None 537 None 14
ENSDART00000017384 Nonsense 421 522 13 14
ENSDART00000097792 Nonsense 421 1410 13 32

The following transcripts of ENSDARG00000009031 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 27345988)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCAACAGCGACGGGAGAGAGAGCTTCGCAAACAACAGGAGAGAGAG[C/T]AGAGGAGGCGCTATGAGGAGATGGAGCAGCTGCGGAGAGAGGAGGAGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008374 Essential Splice Site 510 537 13 14
ENSDART00000017384   None 522 None 14
ENSDART00000097792 Essential Splice Site 1383 1410 31 32

The following transcripts of ENSDARG00000009031 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 27293749)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACAAGCGAGCACAGCGACTGAAGTTCCTGTCTGAGAGAAATGATAAA[G/A]TATGTCAGCAGGATTGTTGTTTTGTTTGCCCCTATTTTATTAATCCTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link