tnikb

Ensembl ID:
ENSDARG00000009031
ZFIN ID:
ZDB-GENE-051113-320
Description:
TRAF2 and NCK interacting kinase b [Source:UniProtKB/TrEMBL;Acc:Q32PQ9]
Human Orthologue:
TNIK
Human Description:
TRAF2 and NCK interacting kinase [Source:HGNC Symbol;Acc:30765]
Mouse Orthologue:
Tnik
Mouse Description:
TRAF2 and NCK interacting kinase Gene [Source:MGI Symbol;Acc:MGI:1916264]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6774 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008374 Nonsense 41 537 2 14
ENSDART00000017384 Nonsense 41 522 2 14
ENSDART00000097792 Nonsense 41 1410 2 32

The following transcripts of ENSDARG00000009031 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 27402055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGAGCTGGTGGAGCTTGTGGGAAATGGRACCTATGGACAAGTATAT[A/T]AGGTAAATATTGACTTTTCTGTTTGATMTGGTTCRTGTGATTGGCTGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/if9zonvi