LOC568926

Ensembl ID:
ENSDARG00000009026
Human Orthologue:
ANK2
Human Description:
ankyrin 2, neuronal [Source:HGNC Symbol;Acc:493]
Mouse Orthologue:
Ank2
Mouse Description:
ankyrin 2, brain Gene [Source:MGI Symbol;Acc:MGI:88025]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31198 Nonsense Available for shipment Available now
sa32620 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39568 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39569 Nonsense Mutation detected in F1 DNA During 2016
sa10761 Essential Splice Site Available for shipment Available now
sa10645 Essential Splice Site Available for shipment Available now
sa19448 Essential Splice Site Available for shipment Available now
sa25542 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39570 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32621 Nonsense Mutation detected in F1 DNA During 2016
sa19449 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Nonsense 160 3760 5 48
Genomic Location (Zv9):
Chromosome 1 (position 12971618)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13400360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCACTCCGCTTTATATGGCTGCTCAAGAGAATCACCTGGATGTTGTG[C/T]GATATCTACTGGAGAACGGCGGAAACCAGAGCATGGCCACAGAGGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Essential Splice Site 174 3760 5 48
Genomic Location (Zv9):
Chromosome 1 (position 12971663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGCGATATCTACTGGAGAACGGCGGAAACCAGAGCATGGCCACAGAG[G/A]TTTTTGATTGACAATTCCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Essential Splice Site 277 3760 8 48
Genomic Location (Zv9):
Chromosome 1 (position 12978877)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13407619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCACGCTGCTGCTCAACAGAGGGGCTGCTGTAGACTTCACAGCCAGG[G/T]TATGAGCTTATACTGTTATATCCTTGCAAAAACATTGGGTTTAAATATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Nonsense 392 3760 11 48
Genomic Location (Zv9):
Chromosome 1 (position 12984789)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13413531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGGACTACCTGACCGCCCTTCATGTGGCCGCACACTGTGGTCACTAC[A/T]GAGTCACCAAATTACTGCTGGACAAGAAAGCAAATCCTAATGCCAGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Essential Splice Site 772 3760 20 48
ENSDART00000021693 Essential Splice Site 772 3760 20 48
Genomic Location (Zv9):
Chromosome 1 (position 12995251)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13423993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTAATTTCCTTTTGCAAAATGKCGCTAATGTTAATGGAAAAACAAAG[G/A]TAAGARTGTACTTCTTTCATCTTTGCCATAATGACAGAACATAATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Essential Splice Site 772 3760 20 48
ENSDART00000021693 Essential Splice Site 772 3760 20 48
Genomic Location (Zv9):
Chromosome 1 (position 12995251)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13423993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTAATTTCCTTTTGCAAAATGKCGCTAATGTTAATGGAAAAACAAAG[G/A]TAAGARTGTACTTCTTTCATCTTTGCCATAATGACAGAACATAATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Essential Splice Site 773 3760 21 48
Genomic Location (Zv9):
Chromosome 1 (position 12996093)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13424835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGAGATAATTACTGTATTGATGAATCTTTTTTTTTCTTTGTACATTC[A/G]GAATGGTTACACACCACTTCATCAAGCTGCTCAACAGGGAAACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Essential Splice Site 805 3760 21 48
Genomic Location (Zv9):
Chromosome 1 (position 12996194)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13424936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCAATGTCCTCCTGCAGCACGGAGCTAAGCCTAATGCTGTTACCATG[G/T]TATGAGCAACACTTGCACTCCCTGAAATCATCTTAATTCTGTATGTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Essential Splice Site 978 3760 27 48
Genomic Location (Zv9):
Chromosome 1 (position 13003939)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13432681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCGTCTTTTAGCCAGTCTACCCCATGCCTTGACCATGACAACAGCAG[G/A]TGATCCTCCACTACTCTTGCTTGAGTCCCATTGCTTTCCATATTCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Nonsense 3368 3760 39 48
Genomic Location (Zv9):
Chromosome 1 (position 13027540)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13456282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACAAGTCCTCTACTGACTTAGGGATAGATAGTAATTTGAAAGCAATT[C/T]GACCTCCGTCTGTAGGCGATGATGTCTTTGAGGCAAGACCCAATTGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Nonsense 3711 3760 47 48
Genomic Location (Zv9):
Chromosome 1 (position 13037176)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13465918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTCAGGTGACTTTCCATGAGAAAGACAGCATTTCGGCTTCAAGGGGG[G/T]AGTCTGCCGCTGGTCAAGAAGTCAGACAGATGGTCCAGACAACAGTGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link