LOC568926

Ensembl ID:
ENSDARG00000009026
Human Orthologue:
ANK2
Human Description:
ankyrin 2, neuronal [Source:HGNC Symbol;Acc:493]
Mouse Orthologue:
Ank2
Mouse Description:
ankyrin 2, brain Gene [Source:MGI Symbol;Acc:MGI:88025]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10645 Essential Splice Site Available for shipment Available now
sa10761 Essential Splice Site Available for shipment Available now
sa19448 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19449 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Essential Splice Site 772 3760 20 48
ENSDART00000021693 Essential Splice Site 772 3760 20 48
Genomic Location:
Chromosome 1 (position 12995251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTAATTTCCTTTTGCAAAATGKCGCTAATGTTAATGGAAAAACAAAG[G/A]TAAGARTGTACTTCTTTCATCTTTGCCATAATGACAGAACATAATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Essential Splice Site 772 3760 20 48
ENSDART00000021693 Essential Splice Site 772 3760 20 48
Genomic Location:
Chromosome 1 (position 12995251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTAATTTCCTTTTGCAAAATGKCGCTAATGTTAATGGAAAAACAAAG[G/A]TAAGARTGTACTTCTTTCATCTTTGCCATAATGACAGAACATAATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Essential Splice Site 773 3760 21 48
Genomic Location:
Chromosome 1 (position 12996093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGAGATAATTACTGTATTGATGAATCTTTTTTTTTCTTTGTACATTC[A/G]GAATGGTTACACACCACTTCATCAAGCTGCTCAACAGGGAAACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021693 Nonsense 3711 3760 47 48
Genomic Location:
Chromosome 1 (position 13037176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTCAGGTGACTTTCCATGAGAAAGACAGCATTTCGGCTTCAAGGGGG[G/T]AGTCTGCCGCTGGTCAAGAAGTCAGACAGATGGTCCAGACAACAGTGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pvgtba42