ankrd28

Ensembl ID:
ENSDARG00000009023
ZFIN ID:
ZDB-GENE-070622-4
Human Orthologue:
ANKRD28
Human Description:
ankyrin repeat domain 28 [Source:HGNC Symbol;Acc:29024]
Mouse Orthologues:
Ankrd28, E230028L10Rik
Mouse Descriptions:
ankyrin repeat domain 28 Gene [Source:MGI Symbol;Acc:MGI:2145661]
RIKEN cDNA E230028L10 gene Gene [Source:MGI Symbol;Acc:MGI:2685285]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2889 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa9605 Essential Splice Site Available for shipment Available now
sa1392 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa2889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027020 Splice Site, Nonsense 37 1054 1 27
ENSDART00000146436 Splice Site, Nonsense 37 1052 2 28
Genomic Location:
Chromosome 16 (position 22202531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCGGATGAAGTACGCTCCCTCATTTTCAAGAAAGAGGATGTGAATGTA[C/T]AAGTAAGGTTTTCAGTTGTCTATTAATAAAATGTGGATTTCTGATGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027020 Essential Splice Site 523 1054 14 27
ENSDART00000146436 Essential Splice Site 523 1052 15 28
Genomic Location:
Chromosome 16 (position 22222779)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAGTGCATTACGCCTCTGCSTATGGACACCGTCTGTGTCTGGARYTG[G/A]TAAGTTACTGGTRAACTTAAAACCACAYAATTCGGTAATTCACATAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1392
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027020 Essential Splice Site 875 1054 23 27
ENSDART00000146436 Essential Splice Site 873 1052 24 28
Genomic Location:
Chromosome 16 (position 22236242)
KASP Assay ID:
554-1304.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACCCCGCTCATGATGGCCGCTGAGAACGGCCAGACTAATGCAGTTGG[T/C]AGGAGTTTGACACTGGATGCCTYAAATGTTTCTGGTTAACTGGGTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/510eomwi