col11a1b

Ensembl ID:
ENSDARG00000009014
ZFIN ID:
ZDB-GENE-070912-607
Description:
collagen alpha-1(XI) chain [Source:RefSeq peptide;Acc:NP_001171883]
Human Orthologue:
COL11A1
Human Description:
collagen, type XI, alpha 1 [Source:HGNC Symbol;Acc:2186]
Mouse Orthologue:
Col11a1
Mouse Description:
collagen, type XI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88446]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19707 Nonsense Mutation detected in F1 DNA During 2014
sa18075 Nonsense Available for shipment Available now
sa18515 Nonsense Available for shipment Available now
sa19706 Essential Splice Site Available for shipment Available now
sa11917 Essential Splice Site Available for shipment Available now
sa18432 Nonsense Available for shipment Available now
sa9895 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Nonsense 13 1815 1 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 None None 892 None 33
Genomic Location:
Chromosome 2 (position 15383190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGGCTCCGGTCATGGATAAGGATAAGGAAAGGTGGTCCACGAGATGG[A/T]AAACGAAAAAGTGTCTCAGGAACTCCGTTTTAAGTGCAATCTTCAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Nonsense 237 1815 5 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 Nonsense 197 265 4 6
ENSDART00000142536 None None 892 None 33
Genomic Location:
Chromosome 2 (position 15338756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGGGACATCCAGCARCTTCTTCTGGTGGCGGATCCTCGTGCAGCCTA[C/A]KACTACTGTGAACACTACAGCCCTGACTGTGAAACCCCTCAYCAGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Nonsense 399 1815 8 67
ENSDART00000133069 Nonsense 69 312 1 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 None None 892 None 33
Genomic Location:
Chromosome 2 (position 15327485)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGATAGACCCCAGCAATTATGATGATTCCTTCTATGACTACACTAAT[G/T]GAGTAAAACCCACCGGATCAACCTATGAGGACGAGATTGGACCTGGACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Essential Splice Site 690 1815 22 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 None None 892 None 33
Genomic Location:
Chromosome 2 (position 15296575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGGACTGACTGGTTTGGATGGACCACCTGGCCCTAAAGGAAACATG[G/T]TAAGTATTTGATCTCCTCCTGTTCAATAGTGTGAGTGTCACTAAAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Essential Splice Site 913 1815 35 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 None None 892 None 33
Genomic Location:
Chromosome 2 (position 15272558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAGTCAAAGCTTTCTSGTAACAAGCACCTGTGACTGTGTTTCTGTTTA[G/T]GGAAYATCAGGAAATGATGGACCAWCTGGTGGCCCAGGAGAGAGAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Nonsense 1054 1815 41 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 Nonsense 131 892 7 33
Genomic Location:
Chromosome 2 (position 15264890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTATTCTCTTTCTGTCNNTTTTTTTGCAGGGYCTGTCAGGTCTGAWG[G/T]GAGGCRAKGGTCCRCAGGRTCCACAARGCCCTAGCGTAAGTACCTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049589 Essential Splice Site 1282 1815 51 67
ENSDART00000133069 None None 312 None 12
ENSDART00000133462 None None 265 None 6
ENSDART00000142536 Essential Splice Site 359 892 17 33
Genomic Location:
Chromosome 2 (position 15235752)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAYCRTGGATGGGTGAGWRCTGGATGTTGATACTTCTAATGTTGCTTCTT[A/G]GGGACCCAAAGGTGAGCTTGGAGAGAAAGGAGAAGCTGGTCCTCCGGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jlbxt3pk