pdip5

Ensembl ID:
ENSDARG00000009001
ZFIN ID:
ZDB-GENE-030131-879
Description:
protein disulfide-isomerase A6 [Source:RefSeq peptide;Acc:NP_922915]
Human Orthologue:
PDIA6
Human Description:
protein disulfide isomerase family A, member 6 [Source:HGNC Symbol;Acc:30168]
Mouse Orthologue:
Pdia6
Mouse Description:
protein disulfide isomerase associated 6 Gene [Source:MGI Symbol;Acc:MGI:1919103]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37069 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020252 Essential Splice Site 233 440 7 13
Genomic Location (Zv9):
Chromosome 20 (position 31249281)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31320494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGCTGTGGACGCCACTGTTCACCAGGGCTTGGCAAGCCGCTTTGGG[G/A]TAGGTCTGAAATCAAACTTATTTTATGTCTTTCATATAAATGATAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020252 Nonsense 295 440 9 13
Genomic Location (Zv9):
Chromosome 20 (position 31251775)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31322988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTAGGTTTTGAATGAAGGCATTTTAAAGAAGACTTGTGAGGATTAT[C/T]AGCTGTGYATCATAGCTGTGCTGCCACAYATTCTAGATACAGGTACGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link