e2f7

Ensembl ID:
ENSDARG00000008986
ZFIN ID:
ZDB-GENE-030131-3527
Description:
transcription factor E2F7 [Source:RefSeq peptide;Acc:NP_001038612]
Human Orthologue:
E2F7
Human Description:
E2F transcription factor 7 [Source:HGNC Symbol;Acc:23820]
Mouse Orthologue:
E2f7
Mouse Description:
E2F transcription factor 7 Gene [Source:MGI Symbol;Acc:MGI:1289147]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20179 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007196 Essential Splice Site 184 723 3 12
ENSDART00000140760 Essential Splice Site 184 723 4 13
Genomic Location:
Chromosome 4 (position 2413867)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCTGAAAGCATCAATATTTCCCTGGATGAAGTGGCCACATGCTTGG[G/T]TAAGAGAAAATGACTGCCAAACACAATCTGTTTATGGGTTGACCTTATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a7wh3tv0