e2f7

Ensembl ID:
ENSDARG00000008986
ZFIN ID:
ZDB-GENE-030131-3527
Description:
transcription factor E2F7 [Source:RefSeq peptide;Acc:NP_001038612]
Human Orthologue:
E2F7
Human Description:
E2F transcription factor 7 [Source:HGNC Symbol;Acc:23820]
Mouse Orthologue:
E2f7
Mouse Description:
E2F transcription factor 7 Gene [Source:MGI Symbol;Acc:MGI:1289147]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33361 Nonsense Mutation detected in F1 DNA During 2016
sa20179 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40203 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007196 Nonsense 104 723 2 12
ENSDART00000140760 Nonsense 104 723 3 13
Genomic Location (Zv9):
Chromosome 4 (position 2415113)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2613992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGAATCTGAAAATGCTGATCAATGCTGCTAGTCCAGATATACGTGAC[A/T]GAGAAATGAAGAAAACCCTCTTCAAACCCATTGAAAATAAAGGGAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007196 Essential Splice Site 184 723 3 12
ENSDART00000140760 Essential Splice Site 184 723 4 13
Genomic Location (Zv9):
Chromosome 4 (position 2413867)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2612746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCTGAAAGCATCAATATTTCCCTGGATGAAGTGGCCACATGCTTGG[G/T]TAAGAGAAAATGACTGCCAAACACAATCTGTTTATGGGTTGACCTTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007196 Nonsense 425 723 8 12
ENSDART00000140760 Nonsense 425 723 9 13
Genomic Location (Zv9):
Chromosome 4 (position 2407675)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2606554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAGCCGGTGGATTACTCCAGGAAAAGCGGGAACAACAGTGCAGTGTG[T/A]CGACTGCAGTTTGGAGACGGGTGAAGATTTGTTTGCTTGTTTACTTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link