golga1

Ensembl ID:
ENSDARG00000008979
ZFIN ID:
ZDB-GENE-040426-1237
Description:
golgin A1 [Source:RefSeq peptide;Acc:NP_957132]
Human Orthologue:
GOLGA1
Human Description:
golgin A1 [Source:HGNC Symbol;Acc:4424]
Mouse Orthologue:
Golga1
Mouse Description:
golgi autoantigen, golgin subfamily a, 1 Gene [Source:MGI Symbol;Acc:MGI:1924149]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9657 Nonsense Available for shipment Available now
sa18926 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12072 Essential Splice Site Available for shipment Available now
sa10260 Nonsense Available for shipment Available now
sa21357 Nonsense Mutation detected in F1 DNA During 2014
sa5500 Nonsense Mutation detected in F1 DNA During 2014
sa21356 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098578 Nonsense 126 862 5 23
ENSDART00000112214 Nonsense 126 341 5 10

The following transcripts of ENSDARG00000008979 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 43541522)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCCAGACAAACAGAGCCAAGATGGCAGAAGCCATGTCCTTAGCRTTA[G/T]AAAAAAAAGACCAGGAGTGGATGGAAAAACTRGCTTCACTGGAGCAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098578 Essential Splice Site 184 862 6 23
ENSDART00000112214 Essential Splice Site 184 341 6 10
ENSDART00000098578 Essential Splice Site 184 862 6 23
ENSDART00000112214 Essential Splice Site 184 341 6 10

The following transcripts of ENSDARG00000008979 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 43540158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCTAGAGGGCTTTCAGCAGCAGGAACTGGCTAAAGTCAAACACATGG[T/A]ACTTTTTTGTTTTGAGTTTTCTATGCTTAGGATTTTCTGTCCTGTGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098578 Essential Splice Site 184 862 6 23
ENSDART00000112214 Essential Splice Site 184 341 6 10
ENSDART00000098578 Essential Splice Site 184 862 6 23
ENSDART00000112214 Essential Splice Site 184 341 6 10

The following transcripts of ENSDARG00000008979 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 43540158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTAGAGGGCTTTCAGCAGCAGGAACTGGCTAAAGTCAAACACATGG[T/A]ACTTTTKTGTTTTGASTTTTCTAWGCTTAGGATTTTCTGTCCTGTGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098578 Nonsense 356 862 11 23
ENSDART00000112214 None None 341 None 10

The following transcripts of ENSDARG00000008979 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 43524846)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTCATCTAACGTCTGCATGTTGTGTGTGTGCATGTAGAAGTCTTCCT[T/A]GGAGCAAAGGTTAGAGGAGGCCAGAGGAGAGTTACTGCAGGAGAAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098578 Nonsense 435 862 13 23
ENSDART00000112214 None None 341 None 10

The following transcripts of ENSDARG00000008979 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 43522992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCTGGAGCAGAGACTGGCGGACTGCGCTGAGAAGATGAAGAGTCTA[C/T]AACAGCAACTCAAAGACAGCCAAATGCACACAGACAAACTGGTACATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098578 Nonsense 495 862 14 23
ENSDART00000112214 None None 341 None 10

The following transcripts of ENSDARG00000008979 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 43521124)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAGCTGCTTGCASTACAGAGAGACAGAGAAACGGAGGCCAACAAAKA[T/G]CAGGACAACCTGGTGTGTGAAAGAGCACTTTATTCACCATTATAAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098578 Nonsense 861 862 23 23
ENSDART00000112214 Nonsense 340 341 10 10

The following transcripts of ENSDARG00000008979 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 43508039)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTCACCCAAAGGTATCATACGACCTTCCATCTCAGGAACATCAAGCT[G/A]GAGCTGAGAAACCCAAAACGGCACATCTCTGAGACCAGGTGAAAGAGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5yeszb79