mdn1

Ensembl ID:
ENSDARG00000008976
ZFIN ID:
ZDB-GENE-041001-138
Description:
Novel protein similar to human MDN1, midasin homolog (Yeast) (MDN1) [Source:UniProtKB/TrEMBL;Acc:Q5R
Human Orthologue:
MDN1
Human Description:
MDN1, midasin homolog (yeast) [Source:HGNC Symbol;Acc:18302]
Mouse Orthologue:
Mdn1
Mouse Description:
midasin homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1926159]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4898 Essential Splice Site, Missense F2 line generated During 2014
sa17093 Essential Splice Site Available for shipment Available now
sa16548 Nonsense Available for shipment Available now
sa23696 Nonsense Mutation detected in F1 DNA During 2014
sa4897 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa23695 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23694 Nonsense Mutation detected in F1 DNA During 2014
sa25134 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4113 Missense, Nonsense Mutation detected in F1 DNA During 2014
sa1349 Nonsense Available for shipment Available now
sa8598 Nonsense Mutation detected in F1 DNA During 2014
sa23693 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6631 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa4898
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Missense 268 5553 5 102
ENSDART00000020923 Missense 268 5539 5 101
ENSDART00000142323 Essential Splice Site 267 2210 None 43
Genomic Location:
Chromosome 20 (position 23922820)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTCTGGTCAGGTGGTGACAGAAGACCTAACAAAGAGTGTTACTGTGG[T/G]ATGTGGGGTGATTCTACCTAGACGGACTCCTCGACAAGATGAACAGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Essential Splice Site 406 5553 7 102
ENSDART00000020923 Essential Splice Site 406 5539 7 101
ENSDART00000142323 Essential Splice Site 381 2210 7 43
Genomic Location:
Chromosome 20 (position 23922233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTACTGGATTCTGCTGGAGGAYATTGATCATGCTCCTTTGGATGTGG[T/A]AAGTGCCAAATGTATAAACGCACTAAAGATATTTAAAAAATCCCTAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Nonsense 1784 5553 37 102
ENSDART00000020923 Nonsense 1785 5539 36 101
ENSDART00000142323 Nonsense 1635 2210 33 43
Genomic Location:
Chromosome 20 (position 23896632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTTGCCAAGGCTTCTGGGAACCATCYTGTCAGGAWCAACCTTTCTGAA[C/T]AAACCGTATGTCAAAGAAATTAGCCAAACACTAATATTGACATATACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Nonsense 2439 5553 49 102
ENSDART00000020923 Nonsense 2438 5539 48 101
ENSDART00000142323 None None 2210 None 43
Genomic Location:
Chromosome 20 (position 23889486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGCTGGACTCTGAGGACTGGGGCAGTGGGTTGTTGTGTGCAGGCGTTT[G/A]GCCAGACCGCATCCCTTCAGCGCTCATGTGCACAGAGGACTCGTGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Essential Splice Site 3060 5553 61 102
ENSDART00000020923 Missense 3060 5539 60 101
ENSDART00000142323 None None 2210 None 43
Genomic Location:
Chromosome 20 (position 23884225)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTTTGAAGAAGAAAAAAACAGCACCCTTGATATGATATTTGTTGTT[G/A]TAAAGGGTCCTGGTATGCTGAGTCGTGCTGTGTGGTCCCGCTCCATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Essential Splice Site 3300 5553 63 102
ENSDART00000020923 Essential Splice Site 3300 5539 62 101
ENSDART00000142323 None None 2210 None 43
Genomic Location:
Chromosome 20 (position 23882367)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTTGAAGAGAGTAGCACAACTGACAACTTCCAACATCCTCGCATTAG[G/A]TAATGAAACATTCAGAATTTTTCTCTTAGAGATTGTCACTTAGGTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Nonsense 3414 5553 64 102
ENSDART00000020923 Nonsense 3414 5539 63 101
ENSDART00000142323 None None 2210 None 43

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 20 (position 23880795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTTTATCCTGATGTGGTGGTGCCTCTGCGGGCAGCTATTTTGCAGGTG[C/T]AGCATGGGATGCGACTCCTGGCTTCTCAGGTGTCCTTTTCAACGACTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Essential Splice Site 3968 5553 None 102
ENSDART00000020923 Essential Splice Site 3968 5539 None 101
ENSDART00000142323 None None 2210 None 43

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 20 (position 23875882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCTAATCAACTAAATGTTTTAAAAATTATACCATTCTATCTGTGGTC[A/G]GGACCCTGTTTAAGTTTGTGAAGAAGTTTGAAGCGGCACTGAAGGAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Missense 4460 5553 81 102
ENSDART00000020923 Nonsense 4460 5539 80 101
ENSDART00000142323 None None 2210 None 43

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 20 (position 23871392)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCACCACCTGGAAAACCCAACTTCTCTCTATCAGACAGTCACAGAAA[C/T]GTAAGAACACATATTAAAATAGAATAAGAATAAAATACTGATNNAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Nonsense 4597 5553 84 102
ENSDART00000020923 Nonsense 4588 5539 83 101
ENSDART00000142323 None None 2210 None 43

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 20 (position 23870485)
KASP Assay ID:
554-1263.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCGTTTGGAGCCCATGCTGTGTCTCTACTCTGAATTGGTGAGGTATTA[T/A]CTTGCTGTGCTGATGGGGGCTCACCGTACCACYGGAAAGCTTTTGTCCGT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
gut
ZFA:0000112
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
melanocyte
ZFA:0009091
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084
increased size
PATO:0000586
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
20:54337471-54337800 54337471 -1 1.18 × 10-152 2.2 -3 hsp90aa1.1 ENSDARG00000010478
1:60218201-60218572 60218572 1 4.01 × 10-100 -4.1 -5 cyp3a65 ENSDARG00000045627
16:28404313-28404900 28404313 -1 1.72 × 10-94 2.9 0 arhgef1b ENSDARG00000055837
22:41086023-41086500 41086023 -1 5.48 × 10-91 -2.8 -4 tm4sf4 ENSDARG00000040747
8:21907052-21907500 21907052 -1 8.51 × 10-82 -8.4 -3 ela2l ENSDARG00000056765

Mutation Details

Allele Name:
sa8598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Nonsense 5156 5553 93 102
ENSDART00000020923 Nonsense 5140 5539 92 101
ENSDART00000142323 None None 2210 None 43

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 20 (position 23865043)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGARGAAGATGAYATYGCGATGGAAGTGGARGAAGAGAAGGAYCTA[C/T]AAGCAGTTGAAGCCCAGGAGCTTAAACCAGAGAAGCTAAATGACAATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Essential Splice Site 5267 5553 None 102
ENSDART00000020923 Essential Splice Site 5247 5539 None 101
ENSDART00000142323 None None 2210 None 43

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 20 (position 23863658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCTTAAATGTGTGTGTATTTATTTGTGTGTTTTGCTGTTGTCCCTC[A/C]GGAGAGTGCTGCTGCAGCGTTGTGGCATCAGTACCAGACCCTGACATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6631
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004209 Nonsense 5333 5553 97 102
ENSDART00000020923 Nonsense 5313 5539 96 101
ENSDART00000142323 None None 2210 None 43

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 20 (position 23862978)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGAAAGTTATTCCCTACATTGCCAGTCAGTTCCGCAAGGATAAGATCT[G/A]GCTGAGGAGAACAAAACCCAGCAAGAGGAAYTACCAGATCTGCCTGGCTG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
gut
ZFA:0000112
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
melanocyte
ZFA:0009091
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084
increased size
PATO:0000586
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g0gm1im3