fgb

Ensembl ID:
ENSDARG00000008969
ZFIN ID:
ZDB-GENE-030131-9261
Description:
fibrinogen beta chain [Source:RefSeq peptide;Acc:NP_997939]
Human Orthologue:
FGB
Human Description:
fibrinogen beta chain [Source:HGNC Symbol;Acc:3662]
Mouse Orthologue:
Fgb
Mouse Description:
fibrinogen beta chain Gene [Source:MGI Symbol;Acc:MGI:99501]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9621 Essential Splice Site Available for shipment Available now
sa298 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa9621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011701 Essential Splice Site 159 485 None 8
ENSDART00000041987 Essential Splice Site None 216 None 11

The following transcripts of ENSDARG00000008969 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 9130967)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCTMRACTATTAAAAATACCCACAAGTAATKGTTTATGTYCTTTCAC[A/C]GGCAATGGACTTGTGGTTGATCAGTACACAGACAGCTTAGAAACCCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa298
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011701 Nonsense 177 485 5 8
ENSDART00000041987 None None 216 5 11

The following transcripts of ENSDARG00000008969 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 9131024)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACTTGTGGTTGATCAGTACACAGACAGCTTAGAAACCCAGCATGCTTA[T/A]ATTAAGGACACGGTGGACGTCACCTTCCCCCAGAACATTAAAGTCCTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Chronic obstructive pulmonary disease-related biomarkers: Genome-wide association analysis of blood biomarkers in chronic obstructive pulmonary disease. (View Study)
  • Fibrinogen: Assessment of genetic determinants of the association of γ' fibrinogen in relation to cardiovascular disease. (View Study)
  • Fibrinogen: Association of novel genetic Loci with circulating fibrinogen levels: a genome-wide association study in 6 population-based cohorts. (View Study)
  • Fibrinogen: Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f76gimjh