tbl1xr1

Ensembl ID:
ENSDARG00000008966
ZFIN ID:
ZDB-GENE-040426-1192
Description:
transducin (beta)-like 1 X-linked receptor 1 [Source:RefSeq peptide;Acc:NP_956903]
Human Orthologue:
TBL1XR1
Human Description:
transducin (beta)-like 1 X-linked receptor 1 [Source:HGNC Symbol;Acc:29529]
Mouse Orthologue:
Tbl1xr1
Mouse Description:
transducin (beta)-like 1X-linked receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2441730]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12656 Nonsense Available for shipment Available now
sa7261 Nonsense Mutation detected in F1 DNA During 2016
sa1795 Missense F2 line generated During 2016
sa32840 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 Nonsense 298 362 10 14
ENSDART00000085132 Nonsense 298 511 8 14
ENSDART00000146360 Nonsense 298 510 10 16
Genomic Location (Zv9):
Chromosome 2 (position 7561035)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7978689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAACTTTCAGACCACYATTATTTGGGACGCACACACAGGAGAGGCCAAA[C/T]AACAGTTTCCATTCCATTCAGGTGAGTGACAAAAATCACAAGCAGGAYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 Nonsense 326 362 11 14
ENSDART00000085132 Nonsense 326 511 9 14
ENSDART00000146360 Nonsense 326 510 11 16
ENSDART00000022663 Nonsense 326 362 11 14
ENSDART00000085132 Nonsense 326 511 9 14
ENSDART00000146360 Nonsense 326 510 11 16
Genomic Location (Zv9):
Chromosome 2 (position 7560795)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7978449
KASP Assay ID:
554-4387.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGACTGGCAGAGCAACAAYACATTTGCRTCCTGCAGCAYAGACAWGTG[T/A]ATTCACGTKTGTAAATTGGGCCAGGAAAGACCAAWCAAAACATTCCWGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1795
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663   None 362 None 14
ENSDART00000085132 Missense 338 511 9 14
ENSDART00000146360 Missense 338 510 11 16
Genomic Location (Zv9):
Chromosome 2 (position 7560760)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7978414
KASP Assay ID:
554-1787.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCACAGACATGTGTATTCACGTGTGTAAATTGGGCCAGGAAAGACCAA[T/A]CAAAACATTCCWGGGCCACACAGTAAGCCTCTTATATCCAGTATAGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 Essential Splice Site 348 362 13 14
ENSDART00000085132 Essential Splice Site 470 511 13 14
ENSDART00000146360 Essential Splice Site 469 510 15 16
Genomic Location (Zv9):
Chromosome 2 (position 7556590)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7974244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCAGCAGTATTGGTGATGGGTTCCCAAATCTCTTCTTGTGTACTGCA[G/A]AGCGGTGCTTTAGTCAACAGCTACAGAGGGACCGGCGGTATTTTTGAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)
  • Esophageal cancer: Genome-wide association study identifies three new susceptibility loci for esophageal squamous-cell carcinoma in Chinese populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link