tbl1xr1

Ensembl ID:
ENSDARG00000008966
ZFIN ID:
ZDB-GENE-040426-1192
Description:
transducin (beta)-like 1 X-linked receptor 1 [Source:RefSeq peptide;Acc:NP_956903]
Human Orthologue:
TBL1XR1
Human Description:
transducin (beta)-like 1 X-linked receptor 1 [Source:HGNC Symbol;Acc:29529]
Mouse Orthologue:
Tbl1xr1
Mouse Description:
transducin (beta)-like 1X-linked receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2441730]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12656 Nonsense Available for shipment Available now
sa8363 Nonsense Mutation detected in F1 DNA During 2014
sa7261 Nonsense Mutation detected in F1 DNA During 2014
sa1795 Missense F2 line generated During 2014

Mutation Details

Allele Name:
sa12656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 Nonsense 298 362 10 14
ENSDART00000085132 Nonsense 298 511 8 14
ENSDART00000146360 Nonsense 298 510 10 16
Genomic Location:
Chromosome 2 (position 7561035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAACTTTCAGACCACYATTATTTGGGACGCACACACAGGAGAGGCCAAA[C/T]AACAGTTTCCATTCCATTCAGGTGAGTGACAAAAATCACAAGCAGGAYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 Nonsense 326 362 11 14
ENSDART00000085132 Nonsense 326 511 9 14
ENSDART00000146360 Nonsense 326 510 11 16
ENSDART00000022663 Nonsense 326 362 11 14
ENSDART00000085132 Nonsense 326 511 9 14
ENSDART00000146360 Nonsense 326 510 11 16
Genomic Location:
Chromosome 2 (position 7560795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGACTGGCAGAGCAACAAYACATTTGCRTCCTGCAGCAYAGACAWGTG[T/A]ATTCACGTKTGTAAATTGGGCCAGGAAAGACCAAWCAAAACATTCCWGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 Nonsense 326 362 11 14
ENSDART00000085132 Nonsense 326 511 9 14
ENSDART00000146360 Nonsense 326 510 11 16
ENSDART00000022663 Nonsense 326 362 11 14
ENSDART00000085132 Nonsense 326 511 9 14
ENSDART00000146360 Nonsense 326 510 11 16
Genomic Location:
Chromosome 2 (position 7560795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGACTGGCAGAGCAACAAYACATTTGCRTCCTGCAGCAYAGACAWGTG[T/A]ATTCACGTKTGTAAATTGGGCCAGGAAAGACCAAWCAAAACATTCCWGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1795
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022663 None None 362 None 14
ENSDART00000085132 Missense 338 511 9 14
ENSDART00000146360 Missense 338 510 11 16
Genomic Location:
Chromosome 2 (position 7560760)
KASP Assay ID:
554-1787.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCACAGACATGTGTATTCACGTGTGTAAATTGGGCCAGGAAAGACCAA[T/A]CAAAACATTCCWGGGCCACACAGTAAGCCTCTTATATCCAGTATAGTAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)
  • Esophageal cancer: Genome-wide association study identifies three new susceptibility loci for esophageal squamous-cell carcinoma in Chinese populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bw850lr1