neo1

Ensembl ID:
ENSDARG00000008937
ZFIN ID:
ZDB-GENE-021031-1
Description:
neogenin [Source:RefSeq peptide;Acc:NP_775325]
Human Orthologue:
NEO1
Human Description:
neogenin 1 [Source:HGNC Symbol;Acc:7754]
Mouse Orthologue:
Neo1
Mouse Description:
neogenin Gene [Source:MGI Symbol;Acc:MGI:1097159]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17579 Essential Splice Site Available for shipment Available now
sa11491 Nonsense Available for shipment Available now
sa34193 Nonsense Mutation detected in F1 DNA During 2017
sa6086 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41029 Nonsense Mutation detected in F1 DNA During 2017
sa21085 Essential Splice Site Available for shipment Available now
sa34192 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060405 Essential Splice Site 25 1428 1 29
ENSDART00000073514   None 1427 None 29
ENSDART00000131011   None 294 None 4
Genomic Location (Zv9):
Chromosome 7 (position 55569034)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53485476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTCTCTCWKTTCTGCCTCACGATCACAGTTTCACATGCTGAAAAAGG[T/A]AAGAATGGGATTGAAGAGCATTCAAACTTTCTGCGGCGCAGCCCGCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060405 Nonsense 260 1428 4 29
ENSDART00000073514 Nonsense 259 1427 4 29
ENSDART00000131011 Nonsense 236 294 3 4
Genomic Location (Zv9):
Chromosome 7 (position 55370250)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53684260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGCGAAAGTGTCCTGCTCCCCTGTGTGGTGACGGGATATCCCACTCCT[G/T]AAATCACATGGATGTACAAAGACCAGCTCATTGAGGACAGGTAGGCAATR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060405 Nonsense 489 1428 9 29
ENSDART00000073514 Nonsense 488 1427 9 29
ENSDART00000131011   None 294 None 4
Genomic Location (Zv9):
Chromosome 7 (position 55290968)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53763542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGAGAAATGCAAGTCACCATTCAGAACCTCATGCCAGACACCAAGTA[T/A]GCCTTCCGTGTGGTGGCGCACAACAAAAACGGCCCTGGAGAGAGTTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060405 Essential Splice Site 628 1428 12 29
ENSDART00000073514 Essential Splice Site 627 1427 12 29
ENSDART00000131011   None 294 None 4
Genomic Location (Zv9):
Chromosome 7 (position 55280554)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53773956
KASP Assay ID:
554-3923.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCAGCTCTCCTCCGCAGAACATGACGGTGGAAGTGCTGAACTCCAAG[G/A]TAAGACTTSAGTTCATGGCTTCAGTGTGTCAGCAGCTGTACTGTAGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060405 Nonsense 649 1428 13 29
ENSDART00000073514 Nonsense 648 1427 13 29
ENSDART00000131011   None 294 None 4
Genomic Location (Zv9):
Chromosome 7 (position 55272342)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53782168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGCAGCCTCCACCAGCCGATGCCCAGAACGGAGAGATCACAGGCTA[C/A]AAGATCCGCTACAGGAAGGGTACGAGGAAGAGCGAGGTGGCGGAGATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060405 Essential Splice Site 1276 1428 26 29
ENSDART00000073514 Essential Splice Site 1275 1427 26 29
ENSDART00000131011   None 294 None 4
Genomic Location (Zv9):
Chromosome 7 (position 55243399)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53811111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCTCCATCGCCACCCCCATCTCTCATCTAGACAGGGCAGAGTCCACAG[G/A]TGAGAGCGCAAGACCTCCATCAAACCTGGACACAAATGGGTTCGTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060405 Nonsense 1404 1428 29 29
ENSDART00000073514 Nonsense 1403 1427 29 29
ENSDART00000131011   None 294 None 4
Genomic Location (Zv9):
Chromosome 7 (position 55236480)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53818030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCTCACCCCACCCCCGCAGTAACCTTCTTCATCTCCCTCAGAATTAC[G/T]AGACGGACGAGTTATCGGAGGAAATGGCCCATCTCGAGGGCTTAATGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link