renbp

Ensembl ID:
ENSDARG00000008931
ZFIN ID:
ZDB-GENE-041212-34
Description:
N-acylglucosamine 2-epimerase [Source:RefSeq peptide;Acc:NP_001119915]
Human Orthologue:
RENBP
Human Description:
renin binding protein [Source:HGNC Symbol;Acc:9959]
Mouse Orthologue:
Renbp
Mouse Description:
renin binding protein Gene [Source:MGI Symbol;Acc:MGI:105940]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12830 Nonsense Available for shipment Available now
sa21344 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046640 Nonsense 213 403 5 10
ENSDART00000139567 Nonsense 213 403 6 11
Genomic Location:
Chromosome 8 (position 38149740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAGAGGTTGCAGAAAAGTACAAAGATCTGAGTGGATGGTGTGTGGAA[C/T]AGATTCTACAGCATATACAGGTCAGTAAACATGAAATATAAGCCTTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046640 Essential Splice Site 306 403 8 10
ENSDART00000139567 Essential Splice Site 306 403 9 11
Genomic Location:
Chromosome 8 (position 38145588)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCTCTTCAGGGTAGAACTCTACTAATATGCATTTGTGTGTGTGAACA[G/A]TTAGAGTGGAATATGAAGCTGTGGTGGCCTCACTGTGAAGCACTGATTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dqk366ix