si:ch211-241e1.5

Ensembl ID:
ENSDARG00000008906
ZFIN ID:
ZDB-GENE-030131-6298
Description:
hypothetical protein LOC567583 [Source:RefSeq peptide;Acc:NP_001119897]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8573 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101107 Nonsense 509 542 3 3
ENSDART00000137477 Nonsense 509 542 4 4
Genomic Location (Zv9):
Chromosome 2 (position 1125873)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1071694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGAAAGCTRAAAAGGSGTACTTGTGAAAYTTCAACAGRRGCTGAAAGA[C/T]GAGAGAAGAACGGAGAGAAGCTGTACTACTGCTCTACATGCGGGATGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link