ctns

Ensembl ID:
ENSDARG00000008890
ZFIN ID:
ZDB-GENE-050522-352
Description:
cystinosin [Source:RefSeq peptide;Acc:NP_001018407]
Human Orthologue:
CTNS
Human Description:
cystinosis, nephropathic [Source:HGNC Symbol;Acc:2518]
Mouse Orthologue:
Ctns
Mouse Description:
cystinosis, nephropathic Gene [Source:MGI Symbol;Acc:MGI:1932872]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1921 Essential Splice Site F2 line generated During 2014
sa14661 Nonsense Available for shipment Available now
sa4403 Essential Splice Site F2 line generated During 2014
sa21844 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1921
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002459 Essential Splice Site 193 384 7 10
Genomic Location:
Chromosome 11 (position 6324066)
KASP Assay ID:
554-1910.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCGTCAACAAGCAGTTCTGATATACAGATGTTAAATGGTGTATTTCC[A/C]GGAGGAATTCTTGAAGAAAGATCCAAACGGAGTCAWTCCTGTGGATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002459 Nonsense 236 384 8 10
Genomic Location:
Chromosome 11 (position 6324593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTTATTAATACNNNNTTTTTTTGYTTGTTTTGTTTTCAGAGAGGTGGG[C/T]AAAAGGTYWCCAAAGTGGCCATTGGGTTATTAGCTATCGGCTGGACCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4403
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002459 Essential Splice Site 329 384 9 10
Genomic Location:
Chromosome 11 (position 6327557)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGGCAGTTTCAGTTTGATCCAGATGTTCCTTGAGGCCTATAACAATGG[T/C]GAGACCACACAAACACTGYCATGTYCTATTTACGGTAAGGGTGGTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002459 Nonsense 342 384 10 10
Genomic Location:
Chromosome 11 (position 6327905)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTTGACAGATAAATGGAGGTTTATATTTGGAGACCCTACTAAGTTC[G/T]GACTGGGCGTCTTTTCCATATTCTTCGACATTTTGTTCATCATACAGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g7x299cc