usp28

Ensembl ID:
ENSDARG00000008880
ZFIN ID:
ZDB-GENE-041008-142
Human Orthologue:
USP28
Human Description:
ubiquitin specific peptidase 28 [Source:HGNC Symbol;Acc:12625]
Mouse Orthologue:
Usp28
Mouse Description:
ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18009 Nonsense Available for shipment Available now
sa1020 Essential Splice Site, Missense Available for shipment Available now
sa23935 Nonsense Mutation detected in F1 DNA During 2014
sa16609 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003076 Nonsense 365 1163 11 26
ENSDART00000147896 Nonsense 243 1041 8 23
Genomic Location:
Chromosome 21 (position 22212891)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGTTGACCTTTGAACTGTCCAGATTTGAGTTCAATCAGTCTTTGGGG[C/T]GACCCGAAAAAATACACAAAAAACTGGAGTTTCCCCAAGTGATCTACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003076 Essential Splice Site 466 1163 14 26
ENSDART00000147896 Missense 344 1041 11 23
Genomic Location:
Chromosome 21 (position 22210496)
KASP Assay ID:
554-0924.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTCTCCTCTGTGTTTGTCCRCCTCTAAATGTTTAATTTCTTGTTGTA[G/A]TCAAACAGAAGCAGATGATGCCGGCTCGTCAGATGGTTCGGGCTGCCCGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa23935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003076 Nonsense 960 1163 22 26
ENSDART00000147896 Nonsense 838 1041 19 23
Genomic Location:
Chromosome 21 (position 22170867)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTTCACAGGGCCGTCAGCATCATGAGAGAGGCCAGATCGAAACTT[C/T]GACTAATTAGACCAGAAGATATGGACATGGATGAGTATTTGGTAAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003076 Nonsense 1069 1163 25 26
ENSDART00000147896 Nonsense 947 1041 22 23
Genomic Location:
Chromosome 21 (position 22167524)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCAGGATGAGAGTGACGTGACGGAGGGAGAGAGCCTCATGAATGAGTG[T/A]GYGATCCCTTGCATGCACCTCATGGTTCGAGACAGTGTCAGCCAAGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nes5zerf