rap1b

Ensembl ID:
ENSDARG00000008867
ZFIN ID:
ZDB-GENE-030131-9662
Description:
Ras-related protein Rap-1b [Source:UniProtKB/Swiss-Prot;Acc:Q6TEN1]
Human Orthologue:
RAP1B
Human Description:
RAP1B, member of RAS oncogene family [Source:HGNC Symbol;Acc:9857]
Mouse Orthologue:
Rap1b
Mouse Description:
RAS related protein 1b Gene [Source:MGI Symbol;Acc:MGI:894315]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20258 Essential Splice Site, Missense Available for shipment Available now
sa31395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042250 Essential Splice Site 42 184 None 8
ENSDART00000132081 Missense 43 184 3 8
Genomic Location (Zv9):
Chromosome 4 (position 17946729)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18889569
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTTTGTGGAGAAGTATGACCCTACAATAGAAGACTCGTACAGAAAGG[C/T]AAGTTCTGCATCATTTCTATTGTCAAACCACTGTCTTAATAATGGATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042250 Nonsense 130 184 6 8
ENSDART00000132081 Nonsense 130 184 6 8
Genomic Location (Zv9):
Chromosome 4 (position 17933988)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18876828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGGCAATAAGTGTGATCTGGAGGACGAGAGGGTGGTGGGCAAGGAG[C/T]AGGGGCAGAATCTTGCCCGGCAGTGGAACAGCTGCGCCTTTCTGGAGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link