si:ch73-56f16.1

Ensembl ID:
ENSDARG00000008866
ZFIN ID:
ZDB-GENE-081104-291
Description:
Novel protein similar to vertebrate calcium binding protein 1 (CABP1) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
CABP4
Human Description:
calcium binding protein 4 [Source:HGNC Symbol;Acc:1386]
Mouse Orthologue:
Cabp4
Mouse Description:
calcium binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1920910]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25388 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017495 Essential Splice Site 51 144 2 3
ENSDART00000137021   None 134 None 5
Genomic Location (Zv9):
Chromosome 8 (position 14316975)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13762319
KASP Assay ID:
554-7404.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTTGTATAGCAGTGAAGATCAATGTGTATGTGTGTGTGTGTGTGTTT[A/G]GGGGGAGGTCACGTGGACTTTGATGATTTCTGTGAATTAATGGGGCCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link