mylipa

Ensembl ID:
ENSDARG00000008859
ZFIN ID:
ZDB-GENE-030131-7831
Description:
E3 ubiquitin-protein ligase MYLIP-A [Source:UniProtKB/Swiss-Prot;Acc:Q6TEM9]
Human Orthologue:
MYLIP
Human Description:
myosin regulatory light chain interacting protein [Source:HGNC Symbol;Acc:21155]
Mouse Orthologue:
Mylip
Mouse Description:
myosin regulatory light chain interacting protein Gene [Source:MGI Symbol;Acc:MGI:2388271]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43288 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013497 Nonsense 406 472 6 7
Genomic Location (Zv9):
Chromosome 19 (position 26861506)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26791618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAGATTGACGCCGCCTTCTGCCCCTGCGGACACATGGTCTGCTGC[C/T]AGAACTGTGCTGCTCAGTTGCAGGTCAGACAACTTTCAGCTTCATTTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
  • Response to statin therapy (LDL-C): Genetic determinants of statin-induced low-density lipoprotein cholesterol reduction: the Justification for the Use of Statins in Prevention: an Intervention Trial Evaluating Rosuvastatin (JUPITER) trial. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link